Stem-loop sequence cel-mir-70

AccessionMI0000041 (change log)
DescriptionCaenorhabditis elegans miR-70 stem-loop
Gene family MIPF0000279; mir-70
Literature search

2 open access papers mention cel-mir-70
(3 sentences)

Stem-loop
   ucaaaaua       ga       c         u     a  a   c  au 
5'         aaacgau  aaacuau gaaauacua cgacg au aca uu  g
           |||||||  ||||||| ||||||||| ||||| || ||| ||   
3'         uuuguua  uuugaua cuuuguggu gcugc ua ugu aa  a
   ------ua       ag       c         u     a  a   a  ga 
Get sequence
Deep sequencing
13847613 reads, 3.89e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 6665536-6665635 [-]
sense
T10H9.5a ; T10H9.5a; intron 1
T10H9.5b ; T10H9.5b; intron 1
T10H9.5c ; T10H9.5c; intron 1
Database links

Mature sequence cel-miR-70-5p

Accession MIMAT0020317
Previous IDscel-miR-70*
Sequence

25 - 

cgaaauacuaucgacgaauaaca

 - 47

Get sequence
Deep sequencing1135 reads, 13 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-70-3p

Accession MIMAT0000042
Previous IDscel-miR-70
Sequence

62 - 

uaauacgucguugguguuuccau

 - 84

Get sequence
Deep sequencing13846462 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7