Stem-loop sequence cel-mir-62

AccessionMI0000033 (change log)
DescriptionCaenorhabditis elegans miR-62 stem-loop
Gene family MIPF0000296; mir-62
Literature search

2 open access papers mention cel-mir-62
(12 sentences)

Stem-loop
   --           cu      -c     c 
5'   gugaguuagau  cauauc  uuccg a
     |||||||||||  ||||||  ||||| a
3'   cauucgaucua  guauag  aaggu a
   ga           au      ua     a 
Get sequence
Deep sequencing
17186 reads, 647 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 12692608-12692665 [+]
sense
T07C5.1b ; T07C5.1b; intron 3
T07C5.1c ; T07C5.1c; intron 3
Database links

Mature sequence cel-miR-62

Accession MIMAT0000034
Sequence

37 - 

ugauauguaaucuagcuuacag

 - 58

Get sequence
Deep sequencing17175 reads, 15 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).