Stem-loop sequence cel-mir-61

AccessionMI0000032 (change log)
DescriptionCaenorhabditis elegans miR-61 stem-loop
Gene family MIPF0000297; mir-61
Literature search

5 open access papers mention cel-mir-61
(12 sentences)

Stem-loop
   uuccauu         -             u    gg  u    c  -  uc 
5'        aucgcugaa ccucgagaugggu acgg  cu aguc uu cc  c
          ||||||||| ||||||||||||| ||||  || |||| || ||  g
3'        uaguggcuu ggagcucuacuca ugcc  ga ucag aa gg  u
   -------         u             u    aa  -    u  c  ua 
Get sequence
Deep sequencing
145495 reads, 1.43e+03 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 11770060-11770156 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-61
cel-mir-61chrV: 11770060-11770156 [-]
cel-mir-250chrV: 11769917-11770015 [-]
Database links

Mature sequence cel-miR-61-5p

Accession MIMAT0015103
Previous IDscel-miR-61*
Sequence

25 - 

uggguuacggggcuuaguccuu

 - 46

Get sequence
Deep sequencing2243 reads, 17 experiments
Evidence experimental; CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-61-3p

Accession MIMAT0000033
Previous IDscel-miR-61
Sequence

61 - 

ugacuagaaccguuacucauc

 - 81

Get sequence
Deep sequencing143166 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).