Stem-loop sequence cel-mir-59

AccessionMI0000030 (change log)
DescriptionCaenorhabditis elegans miR-59 stem-loop
Gene family MIPF0000940; mir-59
Literature search

1 open access papers mention cel-mir-59
(2 sentences)

Stem-loop
          cuagau  g            -      aa     caaaagu    g 
5' aguugau      au acaucguccuga aaacga  cggaa       ucaa a
   |||||||      || |||||||||||| ||||||  |||||       ||||  
3' ucaacua      ua uguaguaggacu uuugcu  gcuuu       aguu u
          --aaau  g            a      aa     -------    a 
Get sequence
Deep sequencing
57842 reads, 753 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 11309154-11309253 [-]
intergenic
Database links

Mature sequence cel-miR-59-5p

Accession MIMAT0015101
Previous IDscel-miR-59*
Sequence

20 - 

ucguccugaaaacgaaacggaa

 - 41

Get sequence
Deep sequencing63 reads, 11 experiments
Evidence experimental; CLIPseq [5]
Predicted targets

Mature sequence cel-miR-59-3p

Accession MIMAT0000031
Previous IDscel-miR-59
Sequence

63 - 

ucgaaucguuuaucaggaugaug

 - 85

Get sequence
Deep sequencing57779 reads, 15 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).