Stem-loop sequence cel-mir-58a

AccessionMI0000029 (change log)
Previous IDscel-mir-58
DescriptionCaenorhabditis elegans miR-58 stem-loop
Gene family MIPF0000282; mir-58
Literature search

19 open access papers mention cel-mir-58a
(215 sentences)

Stem-loop
   ------     ucaua         c    cuu  c        a  -uc  c 
5'       gcucg     uccauugcc uacu   cg aucucauc cu   gu c
         |||||     ||||||||| ||||   || |||||||| ||   || a
3'       cgagu     agguaacgg auga   gc uagaguag ga   ca a
   ugagau     ----c         c    cuu  -        g  uac  u 
Get sequence
Deep sequencing
59587035 reads, 2.91e+05 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 3233254-3233350 [+]
sense
Y67D8A.6 ; Y67D8A.6; exon 1
Y67D8A.2a.1 ; Y67D8A.2a.1; intron 8
Y67D8A.2a.2 ; Y67D8A.2a.2; intron 8
Y67D8A.2b.1 ; Y67D8A.2b.1; intron 8
Y67D8A.2b.2 ; Y67D8A.2b.2; intron 8
Database links

Mature sequence cel-miR-58a-5p

Accession MIMAT0015100
Previous IDscel-miR-58-5p
Sequence

16 - 

ugcccuacucuucgcaucucauc

 - 38

Get sequence
Deep sequencing4079 reads, 17 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-58a-3p

Accession MIMAT0000030
Previous IDscel-miR-58-3p
Sequence

61 - 

ugagaucguucaguacggcaau

 - 82

Get sequence
Deep sequencing59582273 reads, 17 experiments
Evidence experimental; cloned [1-4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).