Stem-loop sequence cel-mir-57

AccessionMI0000028 (change log)
DescriptionCaenorhabditis elegans miR-57 stem-loop
Gene family MIPF0000271; mir-57
Literature search

6 open access papers mention cel-mir-57
(226 sentences)

Stem-loop
   ----------a   aca  c    c    c     a  g    g     u   a 
5'            ucg   ug ucgu uacc uguag uc agcu ugugu uga a
              |||   || |||| |||| ||||| || |||| ||||| ||| c
3'            agc   ac agca gugg acauc ag ucga gcaca acu a
   aaguauuuaga   caa  a    c    a     -  a    -     u   a 
Get sequence
Deep sequencing
282903 reads, 1.6e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 7850499-7850597 [-]
antisense
T09A5.19 ; T09A5.19; exon 1
Database links

Mature sequence cel-miR-57-5p

Accession MIMAT0000029
Previous IDscel-miR-57
Sequence

16 - 

uacccuguagaucgagcugugugu

 - 39

Get sequence
Deep sequencing281690 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-57-3p

Accession MIMAT0020314
Previous IDscel-miR-57*
Sequence

55 - 

acgagcuagacuacaaggugca

 - 76

Get sequence
Deep sequencing1212 reads, 16 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6