Stem-loop sequence cel-mir-56

AccessionMI0000027 (change log)
DescriptionCaenorhabditis elegans miR-56 stem-loop
Gene family MIPF0001735; mir-56
Literature search

5 open access papers mention cel-mir-56
(7 sentences)

Stem-loop
   -ga  -  gu   u     ug     uc    u     ugu   -   ucc 
5'    gc ca  guc guucu  gcgga  cauu ugggu   acc uca   u
      || ||  ||| |||||  |||||  |||| |||||   ||| |||   a
3'    cg gu  cag caaga  cgccu  guaa gccca   ugg agu   a
   cca  u  --   c     gu     uu    u     ---   c   uua 
Get sequence
Deep sequencing
555551 reads, 2.57e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13144691-13144787 [-]
antisense
F09A5.3b ; F09A5.3b; intron 1
Clustered miRNAs
< 10kb from cel-mir-56
cel-mir-54chrX: 13144996-13145094 [-]
cel-mir-55bchrX: 13144830-13144919 [+]
cel-mir-55chrX: 13144827-13144924 [-]
cel-mir-56chrX: 13144691-13144787 [-]
Database links

Mature sequence cel-miR-56-5p

Accession MIMAT0000027
Previous IDscel-miR-56*
Sequence

18 - 

uggcggauccauuuuggguuguacc

 - 42

Get sequence
Deep sequencing1438 reads, 14 experiments
Evidence experimental; cloned [1], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-56-3p

Accession MIMAT0000028
Previous IDscel-miR-56
Sequence

61 - 

uacccguaauguuuccgcugag

 - 82

Get sequence
Deep sequencing553388 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).