Stem-loop sequence cel-mir-55

AccessionMI0000026 (change log)
DescriptionCaenorhabditis elegans miR-55 stem-loop
Gene family MIPF0000270; mir-55
Literature search

3 open access papers mention cel-mir-55
(8 sentences)

Stem-loop
   agauuu    cu   u   a            c   -   u    - uuuu 
5'       ggaa  uaa ggg cucggcagaaac uau cgg uaua c    u
         ||||  ||| ||| |||||||||||| ||| ||| |||| |    g
3'       ccuu  auu ccc gagucgucuuug aua gcc auau g    g
   --uugu    --   c   -            a   u   c    c uaua 
Get sequence
Deep sequencing
485428 reads, 3.1e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13144827-13144924 [-]
antisense
F09A5.3b ; F09A5.3b; intron 1
Clustered miRNAs
< 10kb from cel-mir-55
cel-mir-54chrX: 13144996-13145094 [-]
cel-mir-55bchrX: 13144830-13144919 [+]
cel-mir-55chrX: 13144827-13144924 [-]
cel-mir-56chrX: 13144691-13144787 [-]
Database links

Mature sequence cel-miR-55-5p

Accession MIMAT0020313
Previous IDscel-miR-55*
Sequence

23 - 

cggcagaaaccuaucgguuaua

 - 44

Get sequence
Deep sequencing8699 reads, 17 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-55-3p

Accession MIMAT0000026
Previous IDscel-miR-55
Sequence

61 - 

uacccguauaaguuucugcugag

 - 83

Get sequence
Deep sequencing476715 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6