Stem-loop sequence cel-mir-53

AccessionMI0000024 (change log)
DescriptionCaenorhabditis elegans miR-53 stem-loop
Gene family MIPF0000160; mir-52
Literature search

3 open access papers mention cel-mir-53
(9 sentences)

Stem-loop
   -----      - --    a u c       cau    uu     c    -  u 
5'      ccgauu c  ugac g c acccgua   uugu  ccgug uuga cu c
        |||||| |  |||| | | |||||||   ||||  ||||| |||| ||  
3'      ggcuga g  acug c g uggguau   aaca  ggcac aacu ga a
   uuuaa      u uu    a c c       -au    -c     u    c  a 
Get sequence
Deep sequencing
574093 reads, 1.13e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 11027593-11027691 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-53
cel-mir-53chrIV: 11027593-11027691 [-]
cel-mir-51chrIV: 11026013-11026112 [-]
Database links

Mature sequence cel-miR-53-5p

Accession MIMAT0000024
Previous IDscel-miR-53
Sequence

16 - 

cacccguacauuuguuuccgugcu

 - 39

Get sequence
Deep sequencing573815 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-53-3p

Accession MIMAT0020312
Previous IDscel-miR-53*
Sequence

57 - 

cacggcacaauauaugggucgc

 - 78

Get sequence
Deep sequencing270 reads, 12 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6