Stem-loop sequence cel-mir-52

AccessionMI0000023 (change log)
DescriptionCaenorhabditis elegans miR-52 stem-loop
Gene family MIPF0000160; mir-52
Literature search

3 open access papers mention cel-mir-52
(57 sentences)

Stem-loop
   ----       - --    a u c    gua   a   uuc    c    - ag 
5'     uccaacu c  uaac g c accc   cau ugu   cgug uuga c  c
       ||||||| |  |||| | | ||||   ||| |||   |||| |||| |   
3'     ggguuga g  auug c g uggg   gua aca   gcac aacu g  g
   uucu       a uu    g c a    aaa   -   -uu    u    c aa 
Get sequence
Deep sequencing
726593 reads, 1.61e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 14034008-14034107 [+]
antisense
Y37A1B.335 ; Y37A1B.335; exon 1
Database links

Mature sequence cel-miR-52-5p

Accession MIMAT0000023
Previous IDscel-miR-52
Sequence

17 - 

cacccguacauauguuuccgugcu

 - 40

Get sequence
Deep sequencing720853 reads, 17 experiments
Evidence experimental; cloned [1-4], Northern [1], 454 [5], Illumina [6,8], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-52-3p

Accession MIMAT0020311
Previous IDscel-miR-52*
Sequence

58 - 

cacguuacaaugaaaggguagc

 - 79

Get sequence
Deep sequencing5574 reads, 15 experiments
Evidence experimental; Illumina [8]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
8