Stem-loop sequence cel-mir-51

AccessionMI0000022 (change log)
DescriptionCaenorhabditis elegans miR-51 stem-loop
Gene family MIPF0000268; mir-51
Literature search

7 open access papers mention cel-mir-51
(77 sentences)

Stem-loop
   -------- -   gaaaa u    c    c   g  c  a       -    ggu 
5'         g ucc     g ccgu uacc gua cu cu uccaugu uacu   c
           | |||     | |||| |||| ||| || || ||||||| ||||    
3'         c ggg     c ggca gugg cau ga ga agguaca guga   a
   ucgaagua u   augag -    c    a   g  c  -       a    aaa 
Get sequence
Deep sequencing
267031 reads, 1.78e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 11026013-11026112 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-51
cel-mir-53chrIV: 11027593-11027691 [-]
cel-mir-51chrIV: 11026013-11026112 [-]
Database links

Mature sequence cel-miR-51-5p

Accession MIMAT0000022
Previous IDscel-miR-51
Sequence

17 - 

uacccguagcuccuauccauguu

 - 39

Get sequence
Deep sequencing253640 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-51-3p

Accession MIMAT0015099
Previous IDscel-miR-51*
Sequence

57 - 

cauggaagcagguacaggugca

 - 78

Get sequence
Deep sequencing13354 reads, 17 experiments
Evidence experimental; CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).