Stem-loop sequence cel-mir-50

AccessionMI0000021 (change log)
DescriptionCaenorhabditis elegans miR-50 stem-loop
Gene family MIPF0000266; mir-50
Literature search

3 open access papers mention cel-mir-50
(14 sentences)

Stem-loop
   ------      -        c               ucu       g   uu 
5'       cugccc gccggccg ugauaugucugguau   uggguuu aac  c
         |||||| |||||||| |||||||||||||||   ||||||| |||  c
3'       gacggg cggccggc gcuaugcagauuaua   gcccaag uug  a
   guaaug      g        a               --c       -   cg 
Get sequence
Deep sequencing
90221 reads, 459 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 1738635-1738733 [+]
sense
Y71G12B.11c ; Y71G12B.11c; intron 4
Y71G12B.11a ; Y71G12B.11a; intron 8
antisense
Y71G12B.36 ; Y71G12B.36; exon 1
Database links

Mature sequence cel-miR-50-5p

Accession MIMAT0000021
Previous IDscel-miR-50
Sequence

16 - 

ugauaugucugguauucuuggguu

 - 39

Get sequence
Deep sequencing89826 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-50-3p

Accession MIMAT0020310
Previous IDscel-miR-50*
Sequence

58 - 

cccgcauauuagacguaucgac

 - 79

Get sequence
Deep sequencing388 reads, 11 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6