Stem-loop sequence cel-mir-48

AccessionMI0000019 (change log)
DescriptionCaenorhabditis elegans miR-48 stem-loop
Gene family MIPF0000235; mir-48
Literature search

24 open access papers mention cel-mir-48
(145 sentences)

Stem-loop
   -----------      cc     cu    g      ca  a    c  au  a 
5'            aaacuc  gggaa  ugag uaggcu  gu gaug ga  ug a
              ||||||  |||||  |||| ||||||  || |||| ||  || c
3'            uuugag  cccuu  gcuc auccga  ca cuac cu  au g
   uuguuauggca      -a     ac    g      -c  c    a  cu  g 
Get sequence
Deep sequencing
25275949 reads, 7.23e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 14364412-14364509 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-48
cel-mir-241chrV: 14366188-14366283 [-]
cel-mir-48chrV: 14364412-14364509 [-]
Database links

Mature sequence cel-miR-48-5p

Accession MIMAT0000019
Previous IDscel-miR-48
Sequence

16 - 

ugagguaggcucaguagaugcga

 - 38

Get sequence
Deep sequencing25273504 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-48-3p

Accession MIMAT0015098
Previous IDscel-miR-48*
Sequence

54 - 

acauccaccagccuagcucgca

 - 75

Get sequence
Deep sequencing2423 reads, 13 experiments
Evidence experimental; CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).