Stem-loop sequence cel-mir-46

AccessionMI0000017 (change log)
DescriptionCaenorhabditis elegans miR-46 stem-loop
Gene family MIPF0000087; mir-46
Literature search

2 open access papers mention cel-mir-46
(9 sentences)

Stem-loop
   ---cuga  ugaag           -cg     u      --u   -   c 
5'        gg     cugaagagagc   ucuau gacagu   caa gac a
          ||     |||||||||||   ||||| ||||||   ||| ||| c
3'        cc     gacuucucucg   aggua cugucg   guu cug g
   uaacugg  uagua           cug     -      ugu   g   a 
Get sequence
Deep sequencing
54958 reads, 724 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 13660515-13660611 [+]
intergenic
Database links

Mature sequence cel-miR-46-5p

Accession MIMAT0015096
Previous IDscel-miR-46*
Sequence

15 - 

aagagagccgucuauugacagu

 - 36

Get sequence
Deep sequencing12033 reads, 15 experiments
Evidence experimental; CLIPseq [6], Illumina [7]
Database links
Predicted targets

Mature sequence cel-miR-46-3p

Accession MIMAT0000017
Previous IDscel-miR-46
Sequence

61 - 

ugucauggagucgcucucuuca

 - 82

Get sequence
Deep sequencing42849 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7