Stem-loop sequence cel-mir-45

AccessionMI0000016 (change log)
DescriptionCaenorhabditis elegans miR-45 stem-loop
Gene family MIPF0000132; mir-44
Literature search

3 open access papers mention cel-mir-45
(3 sentences)

Stem-loop
   ---caccau      c          -   gu        aua    ccac 
5'          gugcca gcuggaugug cuc  uagucaua   uccu    a
            |||||| |||||||||| |||  ||||||||   ||||     
3'          cgcggu cgacuuacac gag  aucaguau   agga    a
   uacguaagc      u          a   --        --c    acga 
Get sequence
Deep sequencing
3670911 reads, 2.13e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11880944-11881039 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-45
cel-mir-44chrII: 11890023-11890118 [+]
cel-mir-43chrII: 11889910-11890007 [+]
cel-mir-42chrII: 11889811-11889905 [+]
cel-mir-45chrII: 11880944-11881039 [-]
Database links

Mature sequence cel-miR-45-5p

Accession MIMAT0020772
Sequence

15 - 

cuggaugugcucguuagucaua

 - 36

Get sequence
Deep sequencing58477 reads, 17 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-45-3p

Accession MIMAT0000016
Previous IDscel-miR-45
Sequence

61 - 

ugacuagagacacauucagcu

 - 81

Get sequence
Deep sequencing3612396 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7