Stem-loop sequence cel-mir-44

AccessionMI0000015 (change log)
DescriptionCaenorhabditis elegans miR-44 stem-loop
Gene family MIPF0000132; mir-44
Literature search

4 open access papers mention cel-mir-44
(5 sentences)

Stem-loop
   --     aau      u         -   gu        --   --g  a 
5'   gagaa   ggccaa cuggaugug cuc  uggucaua  gac   uc a
     |||||   |||||| ||||||||| |||  ||||||||  |||   || c
3'   cucuu   ccgguu gacuuacac gag  aucaguau  uug   ag a
   au     cgu      c         a   --        ac   uca  c 
Get sequence
Deep sequencing
3671897 reads, 2.13e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11890023-11890118 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-44
cel-mir-45chrII: 11880944-11881039 [-]
cel-mir-42chrII: 11889811-11889905 [+]
cel-mir-43chrII: 11889910-11890007 [+]
cel-mir-44chrII: 11890023-11890118 [+]
Database links

Mature sequence cel-miR-44-5p

Accession MIMAT0020771
Sequence

16 - 

cuggaugugcucguuggucaua

 - 37

Get sequence
Deep sequencing64484 reads, 17 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-44-3p

Accession MIMAT0000015
Previous IDscel-miR-44
Sequence

61 - 

ugacuagagacacauucagcu

 - 81

Get sequence
Deep sequencing3607341 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7