Stem-loop sequence cel-mir-43

AccessionMI0000014 (change log)
DescriptionCaenorhabditis elegans miR-43 stem-loop
Gene family MIPF0000234; mir-43
Literature search

2 open access papers mention cel-mir-43
(4 sentences)

Stem-loop
   -ua ug    uagu           u    -     a     u   -  aaa 
5'    u  gcac    cgcccgugaca caag aaacu gugau aug cc   c
      |  ||||    ||||||||||| |||| ||||| ||||| ||| ||   c
3'    a  cgug    gcgggcgcugu guuc uuuga cacua uac gg   a
   uug gu    ----           c    a     -     -   a  gac 
Get sequence
Deep sequencing
5456 reads, 33.3 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11889910-11890007 [+]
antisense
ZK930.12 ; ZK930.12; exon 1
Clustered miRNAs
< 10kb from cel-mir-43
cel-mir-45chrII: 11880944-11881039 [-]
cel-mir-42chrII: 11889811-11889905 [+]
cel-mir-43chrII: 11889910-11890007 [+]
cel-mir-44chrII: 11890023-11890118 [+]
Database links

Mature sequence cel-miR-43-5p

Accession MIMAT0020308
Previous IDscel-miR-43*
Sequence

21 - 

gacaucaagaaacuagugauuaug

 - 44

Get sequence
Deep sequencing232 reads, 15 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-43-3p

Accession MIMAT0000014
Previous IDscel-miR-43
Sequence

61 - 

uaucacaguuuacuugcugucgc

 - 83

Get sequence
Deep sequencing5198 reads, 15 experiments
Evidence experimental; cloned [1-4], Northern [1], 454 [5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7