Stem-loop sequence cel-mir-43

Accession MI0000014
Description Caenorhabditis elegans miR-43 stem-loop
Gene family MIPF0000234; mir-43
Stem-loop 
-ua ug    uagu           u    -     a     u   -  aaa 
   u  gcac    cgcccgugaca caag aaacu gugau aug cc   c
   |  ||||    ||||||||||| |||| ||||| ||||| ||| ||   c
   a  cgug    gcgggcgcugu guuc uuuga cacua uac gg   a
uug gu    ----           c    a     -     -   a  gac
Get sequence
Deep sequencing
3480 reads, 6 experiments
Genome context
Coordinates (WBcel215) Overlapping transcripts
II: 11889847-11889944 [+]
antisense
ZK930.12 ; ZK930.12; exon 1
ZK930.12 ; ZK930.12; exon 1
ZK930.12 ; ZK930.12; exon 1
Clustered miRNAs
< 10kb from cel-mir-43
cel-mir-45 II: 11880881-11880976 [-]
cel-mir-42 II: 11889748-11889842 [+]
cel-mir-43 II: 11889847-11889944 [+]
cel-mir-44 II: 11889960-11890055 [+]
Database links

Mature sequence cel-miR-43-5p

Accession MIMAT0020308
Previous IDs cel-miR-43*
Sequence

21 -  

gacaucaagaaacuagugauuaug

 - 44

Get sequence
Deep sequencing 6 reads, 4 experiments
Evidence experimental; Solexa [7]
Predicted targets

Mature sequence cel-miR-43-3p

Accession MIMAT0000014
Previous IDs cel-miR-43
Sequence

61 -  

uaucacaguuuacuugcugucgc

 - 83

Get sequence
Deep sequencing 3474 reads, 6 experiments
Evidence experimental; cloned [1-5], Northern [1], Solexa [6-7]
Validated targets
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
7
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).