Stem-loop sequence cel-mir-42

AccessionMI0000013 (change log)
DescriptionCaenorhabditis elegans miR-42 stem-loop
Gene family MIPF0000233; mir-42
Literature search

7 open access papers mention cel-mir-42
(16 sentences)

Stem-loop
   ----uucgc                 u   uuuu        ---uu  cuu 
5'          ggaccuuuguggguguu gcu    cggugaag     gu   c
            ||||||||||||||||| |||    ||||||||     ||    
3'          ccuggagacaucuacaa ugg    gccacuuc     cg   c
   ggggaaaaa                 u   ----        uucuu  aug 
Get sequence
Deep sequencing
70468 reads, 600 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [5].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11889811-11889905 [+]
antisense
ZK930.12 ; ZK930.12; exon 1
Clustered miRNAs
< 10kb from cel-mir-42
cel-mir-45chrII: 11880944-11881039 [-]
cel-mir-42chrII: 11889811-11889905 [+]
cel-mir-43chrII: 11889910-11890007 [+]
cel-mir-44chrII: 11890023-11890118 [+]
Database links

Mature sequence cel-miR-42-5p

Accession MIMAT0015095
Previous IDscel-miR-42*
Sequence

14 - 

guggguguuugcuuuuucggugaag

 - 38

Get sequence
Deep sequencing2455 reads, 16 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-42-3p

Accession MIMAT0000013
Previous IDscel-miR-42
Sequence

60 - 

ucaccggguuaacaucuacaga

 - 81

Get sequence
Deep sequencing68005 reads, 17 experiments
Evidence experimental; cloned [1-4], Northern [1], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).