Stem-loop sequence cel-mir-36

AccessionMI0000007 (change log)
DescriptionCaenorhabditis elegans miR-36 stem-loop
Gene family MIPF0000096; mir-36
Literature search

5 open access papers mention cel-mir-36
(9 sentences)

Stem-loop
   ca    u        a   c  c           ca   c     - au 
5'   ccgc gucgggga ccg gc aauuuucgcuu  gug uagac c  c
     |||| |||||||| ||| || |||||||||||  ||| ||||| |  c
3'   ggcg cagccccu ggu cg uuaaaaguggg  cac aucug g  a
   -a    -        g   a  c           -c   u     u aa 
Get sequence
Deep sequencing
579548 reads, 4.63e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11537713-11537809 [+]
sense
Y62F5A.14 ; Y62F5A.14; exon 1
antisense
Y62F5A.9 ; Y62F5A.9; intron 2
Clustered miRNAs
< 10kb from cel-mir-36
cel-mir-35chrII: 11537608-11537704 [+]
cel-mir-36chrII: 11537713-11537809 [+]
cel-mir-37chrII: 11537833-11537930 [+]
cel-mir-38chrII: 11537933-11538027 [+]
cel-mir-39chrII: 11538089-11538175 [+]
cel-mir-40chrII: 11538184-11538275 [+]
cel-mir-41chrII: 11538308-11538404 [+]
Database links

Mature sequence cel-miR-36-5p

Accession MIMAT0020304
Previous IDscel-miR-36*
Sequence

20 - 

cgccaauuuucgcuucagugcua

 - 42

Get sequence
Deep sequencing1054 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-36-3p

Accession MIMAT0000007
Previous IDscel-miR-36
Sequence

61 - 

ucaccgggugaaaauucgcaug

 - 82

Get sequence
Deep sequencing578492 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6