Stem-loop sequence cel-mir-34

AccessionMI0000005 (change log)
DescriptionCaenorhabditis elegans miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

10 open access papers mention cel-mir-34
(28 sentences)

Stem-loop
   --------c    --a   c   -a a       -u   u     g   -  uau 
5'          ggac   aug ucg  g ggcagug  ggu agcug uug ca   u
            ||||   ||| |||  | |||||||  ||| ||||| ||| ||    
3'          ccug   uac agc  c ccgucac  cca ucggc aac gu   u
   aaguuucua    cug   a   cc a       uu   -     -   a  ucc 
Get sequence
Deep sequencing
1048011 reads, 2.71e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2969752-2969848 [-]
intergenic
Database links

Mature sequence cel-miR-34-5p

Accession MIMAT0000005
Previous IDscel-miR-34
Sequence

16 - 

aggcagugugguuagcugguug

 - 37

Get sequence
Deep sequencing1036171 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-34-3p

Accession MIMAT0015093
Previous IDscel-miR-34*
Sequence

53 - 

acggcuaccuucacugccaccc

 - 74

Get sequence
Deep sequencing11836 reads, 15 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).