Stem-loop sequence cel-mir-2

Accession MI0000004
Description Caenorhabditis elegans miR-2 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uaa     -au    aa   -         -   ggu       -uu -  a 
   acagu   acag  agc caucaaagc ggu   ugaugug   g ca a
   |||||   ||||  ||| ||||||||| |||   |||||||   | || u
   uguca   uguc  ucg guaguuucg ccg   acuauac   c gu u
---     cgu    cg   u         a   -ac       uuu a  a 
Get sequence
Deep sequencing
33451 reads, 6 experiments
Genome context
Coordinates (WBcel215) Overlapping transcripts
I: 9372760-9372857 [-]
sense
F16A11.3a ; F16A11.3a; intron 5
F16A11.3c.2 ; F16A11.3c.2; intron 5
F16A11.3b ; F16A11.3b; intron 5
F16A11.3c.1 ; F16A11.3c.1; intron 5
F16A11.3a.2 ; F16A11.3a.2; intron 5
F16A11.3a.1 ; F16A11.3a.1; intron 5
F16A11.3b.1 ; F16A11.3b.1; intron 5
F16A11.3c.2 ; F16A11.3c.2; intron 5
F16A11.3b.2 ; F16A11.3b.2; intron 5
F16A11.3c.1 ; F16A11.3c.1; intron 5
F16A11.3a.2 ; F16A11.3a.2; intron 5
F16A11.3a.1 ; F16A11.3a.1; intron 5
F16A11.3b.1 ; F16A11.3b.1; intron 5
F16A11.3c.2 ; F16A11.3c.2; intron 5
F16A11.3b.2 ; F16A11.3b.2; intron 5
F16A11.3c.1 ; F16A11.3c.1; intron 5
F16A11.3d ; F16A11.3d; intron 8
F16A11.3d ; F16A11.3d; intron 8
F16A11.3d ; F16A11.3d; intron 8
Clustered miRNAs
< 10kb from cel-mir-2
cel-mir-71 I: 9379919-9380012 [-]
cel-mir-2 I: 9372760-9372857 [-]
Database links

Mature sequence cel-miR-2-5p

Accession MIMAT0020302
Previous IDs cel-miR-2*
Sequence

20 - 

caucaaagcggugguugaugug

 - 41

Get sequence
Deep sequencing 289 reads, 5 experiments
Evidence experimental; Solexa [9]
Predicted targets

Mature sequence cel-miR-2-3p

Accession MIMAT0000004
Previous IDs cel-miR-2
Sequence

61 - 

uaucacagccagcuuugaugugc

 - 83

Get sequence
Deep sequencing 33162 reads, 6 experiments
Evidence experimental; cloned [1-4,6], PCR [5], Solexa [7,9], CLIPseq [8]
Validated targets
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
6
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
7
8
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
9