Stem-loop sequence cel-mir-2

AccessionMI0000004 (change log)
DescriptionCaenorhabditis elegans miR-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

9 open access papers mention cel-mir-2
(28 sentences)

Stem-loop
   uaa     -au    aa   -         -   ggu       -uu -  a 
5'    acagu   acag  agc caucaaagc ggu   ugaugug   g ca a
      |||||   ||||  ||| ||||||||| |||   |||||||   | || u
3'    uguca   uguc  ucg guaguuucg ccg   acuauac   c gu u
   ---     cgu    cg   u         a   -ac       uuu a  a 
Get sequence
Deep sequencing
50059 reads, 1.6e+03 reads per million, 19 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9372768-9372865 [-]
sense
F16A11.3a ; F16A11.3a; intron 5
F16A11.3b ; F16A11.3b; intron 5
F16A11.3c ; F16A11.3c; intron 5
F16A11.3d ; F16A11.3d; intron 8
Clustered miRNAs
< 10kb from cel-mir-2
cel-mir-71chrI: 9379927-9380020 [-]
cel-mir-2chrI: 9372768-9372865 [-]
Database links

Mature sequence cel-miR-2-5p

Accession MIMAT0020302
Previous IDscel-miR-2*
Sequence

20 - 

caucaaagcggugguugaugug

 - 41

Get sequence
Deep sequencing1531 reads, 16 experiments
Evidence experimental; Illumina [9]
Database links

Mature sequence cel-miR-2-3p

Accession MIMAT0000004
Previous IDscel-miR-2
Sequence

61 - 

uaucacagccagcuuugaugugc

 - 83

Get sequence
Deep sequencing48497 reads, 19 experiments
Evidence experimental; cloned [1-4], PCR [5], 454 [6], Illumina [7,9], CLIPseq [8]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
6
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
7
8
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
9