Stem-loop sequence cel-mir-1

Accession MI0000003
Description Caenorhabditis elegans miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
aaagug    ua   ag           c      gc     -    au 
      accg  ccg  cugcauacuuc uuacau  ccaua cuau  c
      ||||  |||  ||||||||||| ||||||  ||||| ||||  a
      uggu  ggc  gauguaugaag aaugua  gguau ggua  u
---uga    gg   aa           a      -a     a    aa 
Get sequence
Deep sequencing
19093 reads, 6 experiments
Comments

miR-1 was independently identified in C. elegans [1,2] and Drosophila melanogaster (MI0000116 ) [3]. The sequence is also conserved in C. briggsae (MI0000493 ).

Genome context
Coordinates (WBcel215) Overlapping transcripts
I: 6172664-6172759 [-]
antisense
T09B4.14 ; T09B4.14; exon 1
T09B4.14 ; T09B4.14; exon 1
T09B4.14 ; T09B4.14; exon 1
Database links

Mature sequence cel-miR-1-5p

Accession MIMAT0020301
Previous IDs cel-miR-1*
Sequence

21 - 

cauacuuccuuacaugcccaua

 - 42

Get sequence
Deep sequencing 151 reads, 6 experiments
Evidence experimental; Solexa [10]
Predicted targets

Mature sequence cel-miR-1-3p

Accession MIMAT0000003
Previous IDs cel-miR-1
Sequence

61 - 

uggaauguaaagaaguaugua

 - 81

Get sequence
Deep sequencing 18942 reads, 6 experiments
Evidence experimental; cloned [1-2,4-5,7], Northern [1], Solexa [10,8], PCR [6], CLIPseq [9]
Validated targets
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
4
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
5
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
6
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
7
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
8
9
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
10