Stem-loop sequence cel-mir-1

AccessionMI0000003 (change log)
DescriptionCaenorhabditis elegans miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

28 open access papers mention cel-mir-1
(106 sentences)

Stem-loop
   aaagug    ua   ag           c      gc     -    au 
5'       accg  ccg  cugcauacuuc uuacau  ccaua cuau  c
         ||||  |||  ||||||||||| ||||||  ||||| ||||  a
3'       uggu  ggc  gauguaugaag aaugua  gguau ggua  u
   ---uga    gg   aa           a      -a     a    aa 
Get sequence
Deep sequencing
14934141 reads, 6.28e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-1 was independently identified in C. elegans [1,2] and Drosophila melanogaster (MI0000116) [3]. The sequence is also conserved in C. briggsae (MI0000493).

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 6172662-6172757 [-]
antisense
T09B4.14 ; T09B4.14; exon 1
Database links

Mature sequence cel-miR-1-5p

Accession MIMAT0020301
Previous IDscel-miR-1*
Sequence

21 - 

cauacuuccuuacaugcccaua

 - 42

Get sequence
Deep sequencing3293 reads, 16 experiments
Evidence experimental; Illumina [10]
Database links

Mature sequence cel-miR-1-3p

Accession MIMAT0000003
Previous IDscel-miR-1
Sequence

61 - 

uggaauguaaagaaguaugua

 - 81

Get sequence
Deep sequencing14930840 reads, 17 experiments
Evidence experimental; cloned [1-2,4-5], Northern [1], Illumina [10,8], PCR [6], 454 [7], CLIPseq [9]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
4
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
5
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
6
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
7
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
8
9
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
10