Stem-loop sequence cel-lin-4

Accession MI0000002
Previous IDs cel-lin-4L
Description Caenorhabditis elegans lin-4 stem-loop
Gene family MIPF0000303; lin-4
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled lin-4_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology lin-4 is a microRNA (miRNA) that was identified from a study of developmental timing in the nematode Caenorhabditis elegans. It was the first to be discovered of the miRNAs, a class of non-coding RNAs involved in gene regulation. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a 21 nucleotide product. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complete or partial complementarity to mRNA. The lin-4 gene has been found to lie within a 4.11kb intron of a separate host gene (see also ).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --a     ---   g    -uu   u    c    a       u   - u 
5'    ugcuu   ccg ccug   ccc gaga cuca gugugag gua c a
      |||||   ||| ||||   ||| |||| |||| ||||||| ||| |  
3'    acgag   ggc ggac   ggg cucu gggu cacacuu cgu g u
   uag     uuu   a    cau   c    c    c       -   a u 
Get sequence
Deep sequencing
416638 reads, 1.02e+04 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

lin-4 is found on chromosome II in Caenorhabditis elegans [1] and is complementary to sequences in the 3' untranslated region (UTR) of lin-14 mRNA. lin-4 acts to developmentally repress the accumulation of lin-14 protein. This repression is essential for the proper timing of numerous events of Caenorhabditis elegans larval development [2].

Genome context
Coordinates (WBcel235) Overlapping transcripts
chrII: 5902254-5902347 [+]
sense
F59G1.4 ; F59G1.4; intron 9
antisense
F59G1.10 ; F59G1.10; exon 1
Database links

Mature sequence cel-lin-4-5p

Accession MIMAT0000002
Previous IDs cel-lin-4
Sequence

16 - 

ucccugagaccucaaguguga

 - 36

Get sequence
Deep sequencing 366959 reads, 20 experiments
Evidence experimental; cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7]
Validated targets
Predicted targets

Mature sequence cel-lin-4-3p

Accession MIMAT0015092
Previous IDs cel-lin-4*
Sequence

55 - 

acaccugggcucuccggguacc

 - 76

Get sequence
Deep sequencing 136 reads, 13 experiments
Evidence experimental; CLIPseq [7]
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).