Stem-loop sequence cel-let-7

AccessionMI0000001
Previous IDscel-let-7L
DescriptionCaenorhabditis elegans let-7 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------uaca    gga             u              ---  aaua 
          cugu   uccggugagguag agguuguauaguuu   gg    u
          ||||   ||||||||||||| ||||||||||||||   ||     
          gaca   aggccauuccauc uuuaacguaucaag   cc    u
agcuucucaa    --g             u              ugg  acca 
Get sequence
Deep sequencing
4855565 reads, 2.59e+04 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

let-7 is found on chromosome X in Caenorhabditis elegans [1] and pairs to sites within the 3' untranslated region (UTR) of target mRNAs, specifying the translational repression of these mRNAs and triggering the transition to late-larval and adult stages [2].

Genome context
Coordinates (WBcel235) Overlapping transcripts
chrX: 14744173-14744271 [-]
intergenic
Database links

Mature sequence cel-let-7-5p

Accession MIMAT0000001
Previous IDscel-let-7
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Deep sequencing3981460 reads, 21 experiments
Evidence experimental; cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Validated targets
Predicted targets

Mature sequence cel-let-7-3p

Accession MIMAT0015091
Previous IDscel-let-7*
Sequence

60 - 

cuaugcaauuuucuaccuuacc

 - 81

Get sequence
Deep sequencing38 reads, 8 experiments
Evidence experimental; CLIPseq [7]
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).