Stem-loop sequence cel-let-7

AccessionMI0000001 (change log)
Previous IDscel-let-7L
DescriptionCaenorhabditis elegans let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

81 open access papers mention cel-let-7
(1482 sentences)

Stem-loop
   ------uaca    gga             u              ---  aaua 
5'           cugu   uccggugagguag agguuguauaguuu   gg    u
             ||||   ||||||||||||| ||||||||||||||   ||     
3'           gaca   aggccauuccauc uuuaacguaucaag   cc    u
   agcuucucaa    --g             u              ugg  acca 
Get sequence
Deep sequencing
5282521 reads, 3.03e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

let-7 is found on chromosome X in Caenorhabditis elegans [1] and pairs to sites within the 3' untranslated region (UTR) of target mRNAs, specifying the translational repression of these mRNAs and triggering the transition to late-larval and adult stages [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 14744173-14744271 [-]
intergenic
Database links

Mature sequence cel-let-7-5p

Accession MIMAT0000001
Previous IDscel-let-7
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Deep sequencing5282351 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-let-7-3p

Accession MIMAT0015091
Previous IDscel-let-7*
Sequence

60 - 

cuaugcaauuuucuaccuuacc

 - 81

Get sequence
Deep sequencing164 reads, 11 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).