Mature sequence mdo-miR-7374d-5p

Accession numberMIMAT0050434
IDmdo-miR-7374d-5p
Stem-Loop mdo-mir-7374d
Sequence
aagcccuuacccaucuagcuga
Get sequence
Deep sequencing516 reads, 5 experiments

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).