Mature sequence oga-miR-210

Accession numberMIMAT0049660
IDoga-miR-210
Stem-Loop oga-mir-210
Sequence
cugugcgugugacagcggcuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).