Mature sequence csi-miR396f-3p

Accession numberMIMAT0048931
IDcsi-miR396f-3p
Stem-Loop csi-MIR396f
Sequence
gcucaagaaagcugugggaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).