Mature sequence dre-miR-338-3p

Accession numberMIMAT0048673
IDdre-miR-338-3p
Stem-Loop dre-mir-338-3
Sequence
uccagcaucagugauuuuguugc
Get sequence
Deep sequencing5635 reads, 11 experiments

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).