Mature sequence dno-miR-29b-3p

Accession numberMIMAT0047552
IDdno-miR-29b-3p
Stem-Loop dno-mir-29b-1 dno-mir-29b-2
Sequence
uagcaccauuugaaaucaguguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).