Mature sequence bta-miR-2285dj

Accession numberMIMAT0046747
IDbta-miR-2285dj
Stem-Loop bta-mir-2285dj
Sequence
gaaaguuuguucagguuuguccc
Get sequence
Deep sequencing10 reads, 7 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).