Mature sequence bta-miR-2285dh

Accession numberMIMAT0046745
IDbta-miR-2285dh
Stem-Loop bta-mir-2285dh
Sequence
aggacccaaaugaacuuuuugg
Get sequence
Deep sequencing142 reads, 61 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).