Mature sequence bta-miR-11981

Accession numberMIMAT0046370
IDbta-miR-11981
Stem-Loop bta-mir-11981
Sequence
cagggcgggaacgggcugcggga
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).