Mature sequence bta-miR-2285at

Accession numberMIMAT0046342
IDbta-miR-2285at
Stem-Loop bta-mir-2285at-1 bta-mir-2285at-2 bta-mir-2285at-3 bta-mir-2285at-4
Sequence
aaaacccgaaggaacuuuuug
Get sequence
Deep sequencing164 reads, 20 experiments

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).