Mature sequence tca-miR-971b-3p

Accession numberMIMAT0045562
IDtca-miR-971b-3p
Stem-Loop tca-mir-971b
Sequence
uugguguucuaccuuacagugag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).