Mature sequence tca-miR-11624c-5p

Accession numberMIMAT0045544
IDtca-miR-11624c-5p
Stem-Loop tca-mir-11624c
Sequence
auugagacuuuaguauuuucaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).