Mature sequence tca-miR-11618b-5p

Accession numberMIMAT0045495
IDtca-miR-11618b-5p
Stem-Loop tca-mir-11618b-1 tca-mir-11618b-2 tca-mir-11618b-3 tca-mir-11618b-4
Sequence
aguuagcauuggcuguuucuaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).