Mature sequence bdo-miR-210

Accession numberMIMAT0045431
IDbdo-miR-210
Stem-Loop bdo-mir-210
Sequence
uugugcgugugacagcggcuau
Get sequence
Deep sequencing reads, experiments

References

1