Mature sequence gmo-miR-11185-5p

Accession numberMIMAT0044343
IDgmo-miR-11185-5p
Stem-Loop gmo-mir-11185
Sequence
agagggcaauaauaucacau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25881242 "Temperature during early development has long-term effects on microRNA expression in Atlantic cod" Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I BMC Genomics. 16:305(2015).