Mature sequence gma-miR399o

Accession numberMIMAT0041728
IDgma-miR399o
Stem-Loop gma-MIR399o
Sequence
gggcuccucucuccuggcaug
Get sequence
Deep sequencing reads, experiments

References

1