Mature sequence gma-miR4414b

Accession numberMIMAT0041688
IDgma-miR4414b
Stem-Loop gma-MIR4414b
Sequence
agcugcugacucguugguucg
Get sequence
Deep sequencing reads, experiments

References

1