Mature sequence gma-miR399k

Accession numberMIMAT0041672
IDgma-miR399k
Stem-Loop gma-MIR399k
Sequence
ugccaaaggagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1