Mature sequence gma-miR4405b

Accession numberMIMAT0041662
IDgma-miR4405b
Stem-Loop gma-MIR4405b
Sequence
uuccgaauaaccgacuuagaaauc
Get sequence
Deep sequencing reads, experiments

References

1