Mature sequence gma-miR4348d

Accession numberMIMAT0041640
IDgma-miR4348d
Stem-Loop gma-MIR4348d
Sequence
uuucggugucggugaauugcc
Get sequence
Deep sequencing reads, experiments

References

1