Mature sequence ssc-miR-26b-5p

Accession numberMIMAT0041595
IDssc-miR-26b-5p
Stem-Loop ssc-mir-26b
Sequence
uucaaguaauucaggauagguu
Get sequence
Deep sequencing21900 reads, 15 experiments

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).