Mature sequence aga-miR-285-5p

Accession numberMIMAT0041519
IDaga-miR-285-5p
Stem-Loop aga-mir-285
Sequence
acuggcuuccuaucggugcuuaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).