Mature sequence pal-let-7c-5p

Accession numberMIMAT0040140
IDpal-let-7c-5p
Stem-Loop pal-let-7c
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).