Mature sequence aca-miR-9577-5p

Accession numberMIMAT0037588
IDaca-miR-9577-5p
Stem-Loop aca-mir-9577
Sequence
uggcccaaacucuuaugaaauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).