Mature sequence gga-miR-33-2-5p

Accession numberMIMAT0037539
IDgga-miR-33-2-5p
Stem-Loop gga-mir-33-2
Sequence
gugcauuguaguugcauugcau
Get sequence
Deep sequencing24999 reads, 5 experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).