Mature sequence ssc-miR-9854-5p

Accession numberMIMAT0037073
IDssc-miR-9854-5p
Stem-Loop ssc-mir-9854
Sequence
ugugugugaucguuaaugugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).