Mature sequence tae-miR9772

Accession numberMIMAT0036982
IDtae-miR9772
Sequence
ugagaugagauuaccccauac
Get sequence
Stem-Loop tae-MIR9772

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).